Sambamba documentation (2025)

  • view
  • sort
  • index
  • merge
  • slice
  • flagstat
  • markdup

NAME

sambamba-view - tool for extracting information from SAM/BAM files

SYNOPSIS

sambamba view OPTIONS <input.bam | input.sam> [region1 [...]]

DESCRIPTION

sambamba view allows to efficiently filter BAM file for alignmentssatisfying various conditions, as well as access its SAM header andinformation about reference sequences. In order to make these datareadily available for consumption by scripts in Perl/Python/Ruby,JSON output is provided.

By default, the tool expects BAM file as an input.In order to work with SAM file, specify -S|--sam-input command-lineoption, the tool does NOT try to guess file format from extension.Beware that when reading SAM, the tool will skip tags which don't conformto the SAM/BAM specification, and set invalid fields to their default values.However, only syntax is checked, use --valid for full validation.

FILTERING

Filtering is presented in two ways. First, you can specify a conditionwith -F option, using a special language for filtering, described at

https://github.com/lomereiter/sambamba/wiki/%5Bsambamba-view%5D-Filter-expression-syntax

Second, if you have an indexed BAM file, several regions can be specified as well.The syntax for regions is the same as in samtools: chr:beg-end where beg and endare 1-based start and end of a closed-end interval on the reference chr.

JSON

Alignment record JSON representation is a hash with keys 'qname', 'flag', 'rname', 'pos', 'mapq','cigar', 'rnext', 'qual', 'tags', e.g.

{"qname":"EAS56_57:6:190:289:82","flag":69,"rname":"chr1","pos":100,
"mapq":0,"cigar":"*","rnext":"=","pnext":100,"tlen":0,
"seq":"CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA",
"qual":[27,27,27,22,27,27,27,26,27,27,27,27,27,27,27,27,23,26,26,27,
22,26,19,27,26,27,26,26,26,26,26,24,19,27,26],"tags":{"MF":192}}

JSON representation mimics SAM format except quality is given as an array of integers.This format might change in the future.

MsgPack

MessagePack output format is more effective with respect to performance, while almost as easyto parse as JSON representation. Libraries for parsing MessagePack are available for allpopular languages. See http://msgpack.org for more information.

Alignment record representation is an array, per-element description is given below.

[ 0 | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 ]
  • 0 - read name (string)
  • 1 - flag (integer)
  • 2 - reference sequence ID (integer)
  • 3 - 1-based leftmost mapping position (integer)
  • 4 - mapping quality (integer)
  • 5 - lengths of CIGAR operations (array of integers)
  • 6 - types of CIGAR operations (array of chars)
  • 7 - mate reference sequence ID (integer)
  • 8 - 1-based mate leftmost mapping position (integer)
  • 9 - template length (integer)
  • 10 - segment sequence (string)
  • 11 - phred-base quality (array of integers)
  • 12 - tags (map : string -> value)

Header representation is also an array containing the following:

[ 0 | 1 | 2 | 3 | 4 ]
  • 0 - format version (string)
  • 1 - sorting order (string)
  • 2 - @SQ lines (array of maps : string -> value)
  • 3 - @RG lines (ditto)
  • 4 - @PG lines (ditto)

OPTIONS

-F, --filter=FILTER

Set custom filter for alignments.

-f, --format=FORMAT

Specify output format. FORMAT must be one of sam, bam, json, or msgpack (in lowercase).Default one is SAM.

-h, --with-header

Print SAM header before reads. This is always done for BAM output.

-H, --header

Print only SAM header to STDOUT. If FORMAT is sam or bam, its text version isprinted, otherwise JSON object is written.

-I, --reference-info

Output to STDOUT reference sequence names and lengths in JSON (see EXAMPLES).

-c, --count

Output to STDOUT only the number of matching records, -hHI options are ignored.

-v, --valid

Output only valid reads.

-S, --sam-input

Specify that the input is SAM file (default is BAM for all operations).

-p, --show-progress

Show progressbar in STDERR. Works only for BAM files, and with no regionsspecified, i.e. only when reading full file.

-l, --compression-level=COMPRESSION_LEVEL

Set compression level for BAM output, a number from 0 to 9.

-o, --output-filename=FILENAME

Specify output filename (by default everything is written to STDOUT).

-t, --nthreads=NTHREADS

Number of threads to use.

EXAMPLES

Print basic reference sequence information:

 $ sambamba view --reference-info ex1_header.bam [{"name":"chr1","length":1575},{"name":"chr2","length":1584}]

Count reads with mapping quality not less than 50:

 $ sambamba view -c -F "mapping_quality >= 50" ex1_header.bam 3124

Count properly paired reads overlapping 100..200 on chr1:

 $ sambamba view -c -F "proper_pair" ex1_header.bam chr1:100-200 39

Output header in JSON format:

 $ sambamba view --header --format=json ex1_header.bam {"format_version":"1.3","rg_lines":[], "sq_lines":[{"sequence_length":1575,"species":"","uri":"", "sequence_name":"chr1","assembly":"","md5":""}, {"sequence_length":1584,"species":"","uri":"", "sequence_name":"chr2","assembly":"","md5":""}], "sorting_order":"coordinate","pg_lines":[]}

BUGS

There's no way to see validation error messages orto set validation stringency at the moment.

Sambamba documentation (2025)

References

Top Articles
Latest Posts
Recommended Articles
Article information

Author: Kelle Weber

Last Updated:

Views: 6315

Rating: 4.2 / 5 (53 voted)

Reviews: 92% of readers found this page helpful

Author information

Name: Kelle Weber

Birthday: 2000-08-05

Address: 6796 Juan Square, Markfort, MN 58988

Phone: +8215934114615

Job: Hospitality Director

Hobby: tabletop games, Foreign language learning, Leather crafting, Horseback riding, Swimming, Knapping, Handball

Introduction: My name is Kelle Weber, I am a magnificent, enchanting, fair, joyous, light, determined, joyous person who loves writing and wants to share my knowledge and understanding with you.