Cohort study design
The cohort for the longitudinal study included nineteen patients with biopsy-confirmed oral or oropharyngeal squamous cell carcinoma (SCC) and eleven healthy control volunteers, most of which recruited from first-degree relatives of the enrolled cancer patients. The hospital oncology team treated all patients with resection surgery, chemo- or radiation therapy as deemed appropriate, and all participants had a dental evaluation prior to sample collection. Individual clinical information is summarized in Table1 and further detailed in the Supplementary Table. Excluded from the study were patients with squamous cell carcinoma of larynx or hypopharynx. All patients received both chemotherapy (high dose Cisplatin, weekly Cisplatin, Carbo/Taxol or Carboplatin/ 5- fluorouracil) and radiotherapy (in tumour bed or neck), except for one patient who underwent radiation therapy only. Not included in the study were patients receiving immunotherapy or stereotactic body radiation. The study (recruitment, sample collection and data sharing) was approved by the University of Tennessee Health Science Center Knoxville IRB (study number 4652) and all participants provided written informed consent.
Oral cavity squamous cell carcinoma subjects
Eight patients with oral cavity SCC (three males and five females, average age of 65) were enrolled (Table1 and Supplementary TableS1). One patient was deemed medically unresectable, while the other patients were all treated with definitive surgery. Patients received adjuvant radiation therapy using intensity-modulated radiation therapy (IMRT) with 6MV photons to the oral cavity and nodal basins at 2Gray per fraction to 50 Gy. The primary site was treated using a sequential boost to 60 Gy in five patients and to 70 Gy in two patients with a positive margin. All but one patient received concurrent chemotherapy.
Oro-pharyngeal squamous cell carcinoma subjects
Eleven patients with SCC of the oropharynx (nine males and two females, median age of 60) were enrolled (Table1). Among them, 9 were p16 positive (82%). All patients were treated with IMRT with standard fractionation. One patient with a positive margin after resection was treated to 66 Gy with all remaining oropharynx patients were treated to 70 Gy. All oropharyngeal patients received concurrent chemotherapy.
Galera ROMAN clinical trial
Five of the cancer patients (OM16, OM 20, OM22, OM24, and OM28) were concomitantly enrolled on the Galera ROMAN phase 3 clinical trial22 and randomized to placebo or Avasopasem infusion daily one hour prior to radiation therapy. All patients enrolled on the Galera trial were treated with standard of care surgery, chemotherapy, and radiation as determined by their physicians, and were not given other mouthwash formulations. The physicians in the study were blinded to treatment arms of the trial.
Control subjects
Cancer-free control subjects were recruited from relatives of enrolled patients and from the general population. They included 4 males and 7 females between the ages of 24–73 years (Table1 and Supplementary TableS2). Exclusion criteria were recent (within the past month) administration of antibiotics.
Patient assessment
Patients were evaluated weekly for the development of oral mucositis based on the World Health Organization (WHO) Oral Mucositis Assessment Scale23 and the Radiation Therapy Oncology Group (RTOG) Mucositis Assessment Scale. Grade 0 mucositis was reserved for patients with no significant oral findings. Patients with soreness/erythema were classified as grade 1. The presence of ulcers with preservation of ability to eat solid food was described as grade 2, whereas ulcers that required liquid diet only was classified as grade 3. Grade 4 mucositis was diagnosed when alimentation was not possible. The patients’ diet was recorded each week as solid food, soft food, liquids only, or NPO (all nutrition provided through a feeding tube). The presence or absence of thrush was recorded each week along with the use of any antibiotics, steroids and mouthwash (see Supplementary TableS1 for associated metadata).
Sample collection and processing
Unstimulated whole saliva samples and mucosal swabs were collected to evaluate the oral cavity microbiome. Initial samples were collected 7–10 days prior to the initiation of radiation or chemo-radiation treatments. Additional samples were collected again during the third week of radiation therapy (12–15 Gy) at a time point expected to coincide with mild mucositis. A third round of samples was collected between a dose of 60–70 Gy to correspond with severe mucositis stage. A final sample was collected one month after completing therapy. Samples were collected from healthy control participants at similar four time points as the SCC cancer patients to examine normal variations occurring in the oral cavity microbiome of healthy participants over time. Some samples could not be collected from some subjects. A schema of the sampling strategy is presented in Fig.1.
Longitudinal sampling design for control and cancer subjects. Saliva (S), oral mucosa swab samples from tumour (T) or normal site (N) were collected at weeks 0, 2, 7 and 11. The number indicate absence (0, no shading) or presence (shaded) of mucositis of various grades (1,2,3) and/or thrush (x). Administration of anti-fungal medication is indicated by the star symbols. The cartoons summarize the type of collected samples.
All subjects provided 1 ml of saliva by passive drool into a cryovial using a Saliva Collection Aid (Salimetrics LLC, State College, PA). However, due to xerostomia that develops during radiation therapy collection of saliva was not possible in some patients during the third week of therapy and in most patients during the final week of radiation. Sterile rayon-tipped swabs (Copan Diagnostics Inc, CA, USA) were used to sample the mucosa or site of mucositis within the oral cavity or oropharynx by rolling/rubbing the swab over the affected surface. In cancer patients, one sample was collected from the tumour site or resection bed at each time point and a second sample was collected from the contralateral oral cavity or oropharynx. In healthy volunteers only a single swab was collected from the entire buccal mucosa at each time point. Swabs were immediately preserved in 1 ml of S1 Lysis buffer (PureLink™ Microbiome DNA Purification Kit, Invitrogen, Thermo Fisher Scientific, Waltham, MA). Swabs and saliva were transferred to the University of Tennessee Medical Canter Biorepository and stored at −80 °C until further processing. All participants and retrieved specimens were assigned a unique code in the biorepository. Only de-identified specimens were used for DNA extraction, amplicon sequencing, and data analyses.
For DNA extraction we used the PureLink Microbiome DNA Purification Kit following the manufacturers’ protocol for saliva and buccal swaps. Either 200 µl of saliva mixed with 600 µl of S1 lysis buffer or 800 µl of lysis buffer from preserved swabs were used. DNA concentration was determined using the Qubit dsDNA BR Assay kit (Life Technologies, Thermo Scientific Inc, Waltham, MA) with a Qubit 4 Fluorometer (Invitrogen, Thermo Fisher Scientific, Waltham, MA). Extracted DNA was aliquoted and stored at −80 °C.
Amplicon library preparation and sequencing
To generate the amplicon libraries, we used the Zymo Quick-16S™ NGS Library Prep Kit (Zymo Research Corporation, Irvine, CA, USA) with the multi-step Real Time Polymerase Chain Reaction approach, following manufacturer’s instructions. In the first step, Targeted Sequence Amplification was performed using a forward and reverse primer mix that targets the V4 variable region of the 16S rRNA gene of Archaea and Bacteria (515FYM: 5′GTGYCAGCMGCCGCGGTAA; 515F_TM7:5′GTGCCAGCMGCCGCGGTCA; 515Propioni: 5′ GTGCCAGCAGCCGCGGTGA; 806 R: 5′GGACTACNVGGGTWTCTAAT; 806R_Propioni: 5′GGACTACCAGGGTATCTAAG, at a ratio 40:5:5:45:5). The primers were fused to Illumina adapter sequences (5′ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG for the forward primers and 5′ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG for the reverse primers), according to manufacturer specifications. For fungi, we used primers targeting the ITS2 region, ITSF:5′CATCGATGAAGAACGCAG and ITSR:5′ TCCTSCGCTTATTGATATGC, also fused to Illumina adapters. The reactions were set up according to kit’s instructions and the PCR was performed in a BioRad iCycler instrument with the following conditions: 95 °C for 10 min, then 32 cycles of 95 °C for 30 seconds, 55 °C for 30 seconds, and 72 °C for 3 min, followed by fluorescence read. After completion of target sequence amplification, enzymatic reaction cleanup was performed at 37 °C for 15 minutes, followed by inactivation at 95 °C for 10 min. Amplicon libraries were then barcoded using the ZymoBIOMICS Index Primer Set’s A, B, and C in a 5-cycle real time PCR reaction, following the kit protocol. Barcoded amplicons were pooled and purified using the Zymo Select-a-Size DNA Clean & Concentrator MagBead kit. Paired end sequencing (2 × 300 bp) of pooled amplicon libraries was performed on an Illumina MiSeq instrument (Illumina, San Diego, CA).
Sequence analyses
Forward and reverse sequence reads were demultiplexed on the Miseq instrument and assigned to the individual samples based on barcodes. The sequences were imported as paired fastq files into QIIME224. The DADA2 plugin was used to trim, denoise, pair, purge chimeras and select amplicon sequence variants (ASVs), using the command “qiime dada2 denoise-paired”. Taxonomy was assigned using a pre-trained Naive Bayes classifier based on the SILVA 16S rRNA database (v138)25 trimmed to the 515 F/806 R region or the Unite (ITS) database26 for fungal sequences. Unassigned sequences, mitochondrial, and chloroplast sequences were removed. Summaries of the most relatively abundant genera and species of bacteria and fungi, averaged by subject category, are shown in Fig.2. Sequence variant based richness and Shannon diversity were calculated within QIIME2 and tested for phenotype and sample type with ANOVA and Tukey HSD. Beta diversity (using Bray-Curtis dissimilarity distances) was calculated with the Phyloseq package in R and tested for phenotype and sample type with Permanova.
Microbiome diversity in healthy controls and cancer subjects. The most relatively abundant bacteria and fungi identified in healthy and cancer subjects were averaged across all sample types and timepoints for healthy subjects. For cancer subjects, data was averaged for weeks 0 and 7, respectively.
